IJPAB English - Simdos.unud.ac.id

Transcription

HomeAbout USInstructions to AuthorsArchivesContact UsdownloadCrossRef @ IJPAB JournalsIJPAB is CrossRef enabled Journals. The DOI prefix allotted for IJPAB Journals is 10.18782.All published papers in IJPAB Journals will get individual DOI (Digital Object Identifier) byCrossref with published paper.Journal MetricsAbbreviation: Int. J. Pure App. Biosci.CODEN: IJPABLanguage: EnglishISSN: 2320 – 7051Start Year: 2013

Publication: 6 issue pre yearDOI: 10.18782/2320-7051Published Articles: 633International Citation Report (ICR)Impact factor:Global Impact Factor: 0.654 (2015)ISI Impact Factor: 1.106 (2014)SJIF Impact Factor: 5.358 (2015)CitationWelcome to IJPABInternational Journal of Pure & Applied Bioscience (IJPAB) is a peer reviewed, bimonthly, open accessonline official international journal. It publishes original reviews, research articles and short communicationsfrom the field of Biotechnology, Microbiology, Enzymology, Biochemistry, Bioinformatics, Biophysics, Cellbiology, Cellular and Developmental Biology, Ecology , Entomology, Ethnobotany, Ethno pharmacology, Ethnoveterinary, Evolutionary Biology, Genetics and Genomics, Horticulture, Molecular biology, Morphology,Nutrition, Pathogen Resistance, Pest Management and Plant Pathology all other related areas.IJPAB’s mission is to provide a platform established with the aim of motivating to the scientific persons asauthors, researchers, professionals, teachers and their students, assisting them improve their knowledge.International Journal of Pure & Applied Bioscience (IJPAB) has an editorial policy of publishing original, highscientific quality and interesting reviews, research articles and short communications. International Journal ofPure & Applied Bioscience (IJPAB) to publish research articles in all areas of human study without financialrestriction to readers using the open access model of publication.Authors can submit valuable research work/ knowledge as manuscript for forthcoming issue. Get decision onyour manuscript within week from the date of submission. For submission, send your manuscript at:editor@ijpab.com or submitijpab@gmail.com or submit@ijpab.comIndexed and Abstracted in:

Recently Published Issues See allrchives - 2016 Volume 4, issue 2March - April 2016 Volume 4, Issue 2 - Journal Cover PageDownload pdf1. Evaluation of Diclofenac effect on oxidative stressed miceBENKHASSI Zoubair, LAHLOU Fatima Azzahra, HMIMID Fouzia, LOUTFIMohammed, BENAJI Brahim and BOURHIM Noureddine

Page No: 1-8Download pdfdoi: entde biologie, laboratoirede Biochimieet Biologie Moléculaire Faculté desSciences Ain Chock, Université Hassan II-Casablanca, km 8 route d’El Jadida BP. 5366Casablanca, MoroccoDownload :2.0Impact of Artificial Feed on Survival and Growth of Rainbow Trout, Oncorhynchus mykiss(Walbaum) during Exogenous Feeding in Raceways of Kathmandu, NepalRakesh Prasad Bhagat and Sudip BaratPage No: 9-16Download pdfdoi: t of Zoology, Tri-Chandra Multiple Campus, Tribhuvan University, Kathmandu44600, NepalDownload :03. Comparıson of the Diagnostıc Value of HbA1c with Fructosamıne in Dıabetes MellitusHesna URAL KAYALIK, Tuba CANDAR, Selda DEMİRTAS and Sema CETINPage No: 17-26Download pdfdoi: http://dx.doi.org/10.18782/2320-7051.2244Ufuk University, Vocational School of Health Services, Ankara, TURKEYDownload :04. A Bility of Sediments Fungi in Biodegradation of Diesel FuelIhsan Flayyih Hasan AI-JawhariPage No: 27-37Download pdf

doi: t of Environment and Pollution, Marshes Research Centre, Thi-Qar University,IraqDownload :5.Studies on traditional medicinal plants in Ambagiorgis area of Wogera District, Amhara RegionalState, EthiopiaZelalem Getnet, Subramanian Chandrodyam and Getinet MasreshaPage No: 38-45Download pdfdoi: t of Biology, College of Natural and Computational Sciences, University ofGondar, EthiopiaDownload :06. A Survey Study on the Practice of Entomophagy in Sekoma, BotswanaJohn Cassius Moreki, Tshepiso Petere and Kebadire TlotlengPage No: 46-52Download pdfdoi: t of Animal Science and Production, Botswana University of Agriculture andNatural Resources, Private Bag 0027, Gaborone, BotswanaDownload :07. A checklist of Fishes and Fisheries of the Padda (Padma) River near Rajshahi CityFarjana Habib, Shahrima Tasnin and N.I.M. Abdus Salam BhuiyanPage No: 53-57Download pdfdoi: http://dx.doi.org/10.18782/2320-7051.2248

Department of Zoology, University of Rajshahi, BangladeshDownload :8.0Essential Steps of Bread making Process Due to Relevant Rheological Parameters of the RawMaterialJean Didier KOUASSI-KOFFI, Amedée Pascal AHI, Betty Meuwiah FAULET,TiaJean GONNETY, Vlad MURESAN, Elena MUDURA and Emma ASSEMANDPage No: 58-70Download pdfdoi: http://dx.doi.org/10.18782/2320-7051.2265Food Engineering Department, Faculty of Food Science and Technology, University ofAgricultural Sciences and Veterinary Medicine Cluj-Napoca - RO-400509 - Cluj-Napoca,64 Calea Floreşti, RomaniaDownload :9.0In-Silico Structural Modelling of Transaldolase from Helicobacter pylori (Strain G27) A Class ITransaldolaseRabiu Salihu, Ismail Haruna, Hassana Abubakar, Mohd Shahir Shamsir and SepidehParvizpourPage No: 71-77Download pdfdoi: http://dx.doi.org/10.18782/2320-7051.2255Faculty of Biosciences and Medical Engineering, University Technology Malaysia, 81310Skudai, Johor, MalaysiaDownload :10.0Molecular Identification of Mushroom Causing Wilt Disease in Clove Plants (Syzygiumaromaticum L.)I Wayan Suanda, I Made Sudana, I Gede Rai Maya Temaja, Ni Putu Ristiati and IGNAlit Wirya SusantaPage No: 78-84Download pdf

doi: http://dx.doi.org/10.18782/2320-7051.2263Study Program of Agricultural Sciences Udayana University, Bali, IndonesiaDownload :011. Antioxidant activity of water extracts of some medicinal plants from Herzegovina regionMaja Kazazic, Maida Djapo and Emina AdemovicPage No: 85-90Download pdfdoi: t of Chemistry, Faculty of education, Džemal Bijedić University of Mostar,Bosnia and HerzegovinaDownload :12.0Factors affecting seasonal abundance of gastropods of public health importance found at AguluLake shorelines in NigeriaO.O. Ikpeze and M.E. ObikweluPage No: 91-102Download pdfdoi: t of Parasitology & Entomology, Nnamdi Azikiwe University, PMB 5025,Awka, NigeriaDownload :13.0A Study on Inhibitory Effect of Trichoderma sp. TKD on Aspergillus flavus FNCC6109 and ItsMolecular IdentificationIBG Darmayasa and I Gst Lanang OkaPage No: 103-110Download pdfdoi: ogy Laboratory (FMIPA) Faculty of Mathematics and Natural Sciences, Udayana

University, IndonesiaDownload :14.0Protective effect of ZnCl2 on toxicity produced by Microcystin-LR on Serum Calcium andPhosphate levels of freshwater catfish Heteropneustes fossilisChandra Prakash, Mani Ram Prasad, Abhishek Kumar, Diwakar Mishra, ArchanaChaudhary and Sunil K. SrivastavPage No: 111-117Download pdfdoi: t of Zoology, D.D.U. Gorakhpur University, Gorakhpur 273009, IndiaDownload :0Editorial, Advisory Board Member & ReviewerEditor-in-ChiefAssociate Editor (Life Sciences)Dr. Jitendra MehtaDr. Anju VermaHead and Scientist, Dept. of BiotechnologyScientist & Postdoctoral Research& Microbiology, Vital Biotech,Associate, 315 Bond Life Sciences CenterFaculty of Biology, Lzebra Institute, CareerUniversity of Missouri, USA, 1201Point University, Kota, Rajasthan, IndiaRollins Road,, Columbia, MO 65211E mail: editor@ijpab.com [Click Here]E mail: vermaan@missouri.edu [ClickHere]Executive EditorDr. Neerja SrivastavaAssociate Editor (Healthcare)Senior Lecturer, Department of BotanyDr. Afrozul HaqGovt. P.G. College, Kota, Rajasthan, IndiaPrincipal Scientist, R & D Division, VPSE mail: neerajasrivastava143@gmail.comHealthcare, Abu Dhabi, UAE[Click Here]E mail: drafrozulhaq@vpshealth.com[Click Here]Dr. Nagasamy VenkateshAssistant Professor, Dept. of PharmaceuticsAssociate Editor (Pathology &Jss College Of Pharmacy, Ooty-643 001.Immunology)Tamil Nadu, IndiaDr. Sachin Kumar GuptaE mail:Post-doctorate Associate, Department ofnagasamyvenkatesh@rediffmail.com [Click Pathology & ImmunologyHere]Baylor College of Medicine, One BaylorPlaza, Houston, TX, 77030, USAE mail: sachinkgupta1708@gmail.comProf. (Dr.) A.N. Pathak, Ph.D. (Biochem.

Eng.–IIT Delhi), Post. Doc. Germany & USA [Click Here]Dean Research, Amity UniversityRajasthan, Jaipur, IndiaDr. Ashok Kumar VERMACoordinator – Amity Academic StaffAsst. Professor, Dept. of ZoologyCollege (AASC), AUR, JaipurGovt. PG College Saidabad-AllahabadEx – Senior Manager (Pfizer Corporation, (U.P) 221508 IndiaU.S.A.)E mail: akv.apexz@gmail.com [ClickE mail: anpathak2004@gmail.com [ClickHere]Here]Dr. Ved Kumar MishraDr. Maulin P. ShahAssistant Professor, Dept. ofChief Scientist & Head, Industrial WasteBiotechnologyWater Research LaboratoryAshoka Institute of Technology andDivision of Applied & EnvironmentalManagement, Pahadiya, Sarnath, VaranasiMicrobiologyAffiliated by- Dr. A. P. J. Abdul KalamEnviro Technology Limited AnkleshwarTechnical University, Lucknow, U. P.-India393002 Gujarat, IndiaE mail: ved.m45@gmail.com [Click Here]E mail: shahmp@uniphos.com [Click Here]Dr. M.K. MeenaDr. Sanjay Shamrao NanwareAssistant Professor (Crop Physiology)Assistant Professor in Zoology, Department University of Agricultural Sciences,of ZoologyRaichur, Karnataka, IndiaShri Sharda Bhavan Edu. Society's,E mail: meenam4565@gmail.com [ClickYeshwant Mahavidyalaya, Nanded, (M.S.)Here]IndiaE mail: snanware@rediffmail.com [ClickDr. Nayan RoyHere]Assistant Professor Dept. of ZoologyM. U. C. Women’s College, BurdwanDr. Girish K. Goswami713104 West Bengal, IndiaProfessor and Campus DirectorE mail: nayan909@gmail.com [ClickCU Shah Institute of Life Sci., C.U. ShahHere]University, Surendranagra, Gujarat, IndiaE mail: girishkgoswami@gmail.com [ClickDr. Kiran ChoudharyHere]Sr. Lecturer, Deptt. of Botany, M.B. PGCollege, Kota, Rajasthan, IndiaDr. Krishnendra Singh NamaE mail: choudharykiran01@gmail.comSr. Lecturer, Deptt. of Botany, M.B. PG[Click Here]CollegeCareer Point University, Kota, Rajasthan,Dr. Dhanraj Balbhim BhureIndiaAssistant Professor in Zoology,E mail: namasahib@gmail.com [Click Here] Department of ZoologyShri Sharda Bhavan Edu. Society's,Dr. Santanu SarmaYeshwant Mahavidyalaya, Nanded, (M.S.)Ass. Professor, Dept. of ZoologyIndiaBholanath College, Dhubri-783324, Assam, E mail: drajbhure82@gmail.com [ClickIndiaHere]

E mail: dr.santanusarma111@gmail.com[Click Here]Dr. Priyanka SharmaYoung scientist, Gold medalist, Universityof Kota, Rajasthan , IndiaConservation Pteridologist at Cape Town,South AfricaE mail: priyankasharma17aug@gmail.com[Click Here]Dr. Manjul MishraHead and Lecturer, Dept. of ChemistryM. D. Mission College, Keshavpura, Kota,Rajasthan, IndiaE mail: manjulmishra7@gmail.com [ClickHere]Dr. Arshia ParveenAssistant Professor, Department ofChemistryB. Raghunath Arts, Comm. and ScienceCollege, Parbhani (M.S.) IndiaE mail: arshiairfanmalik@gmail.com [ClickHere]Dr. Tahira BegumLecturer (Botany) Govt College, Ajmer(Raj) 305001E mail: tahira786333@gmail.com [ClickHere]Dr. Shivali KharoliwalHead and Lecturer, Dept. of BotanyLzebra Girls College, Dadabari, Kota,Rajasthan, IndiaE mail: kharoliwalshivali76@gmail.com[Click Here]Dr. Monjit SaikiaAssociate Professor & HOD, Deptt, ofBotany, Hojai College,Hojai, Nagaon, Assam, IndiaE mail: mondion37@yahoo.co.in [ClickHere]Dr. Mathews PlamoottilHOD & Assistant Professor in Zoology,Department of ZoologyBaby John Memorial Govt. College,Chavara, Kollam, Kerala, IndiaE mail: mathewsplamoottil@gmail.com[Click Here]Dr. Jeeva. SHead and Ass. Professor, Dept. ofMicrobiologyUdaya College of Arts and Science,Vellamodi, Tamilnadu, IndiaE mail: jeevarajaseker@gmail.com [ClickHere]Dr. Subha GangulyAssociate Professor and HEAD, Dept. ofVeterinary Microbiology,Arawali Veterinary College N.H. - 52Jaipur Road, V.P.O. Bajor,Dist. Sikar, Pin - 332001, Rajasthan, IndiaE mail: ganguly38@gmail.com [ClickHere]Dr. Madhumati BoraHead (Biotech, Genetics &Bioinformatics) N.V. Patel College ofPure & Applied Sciences, VallabhVidyangar, Anand -388120, Gujarat, IndiaE mail: drmadhumatibora@gmail.com[Click Here]

Available online at www.ijpab.comDarmayasa and OkaInt. J. Pure App. Biosci. 4 (2): 103-110 (2016)DOI: http://dx.doi.org/10.18782/2320-7051.2254ISSN: 2320 – 7051ISSN: 2320 – 7051Int. J. Pure App. Biosci. 4 (2): 103-110 (2016)Research ArticleA Study on Inhibitory Effect of Trichoderma sp. TKD on Aspergillus flavusFNCC6109 and Its Molecular IdentificationIBG Darmayasal* and I Gst Lanang Oka2Microbiology Laboratory (FMIPA) Faculty of Mathematics and Natural Sciences, Udayana University, Indonesia*Corresponding Author E-mail: darm aponk@yahoo.co.idReceived: 29.03.2016 Revised: 11.04.2016 Accepted: 15.04.2016ABSTRACTAspergillus flavus is one type of fungus that often cause problems in the field of agriculture andanimal husbandry. Biological control is necessary in order to reduce the use of synthetic fungicideswhich have good side effect on humans and the environment. Exploratory research that has beendone shows a candidate isolate potential to inhibit the growth of Aspergillus flavus. These isolates,isolated from the rhizosphere of corn and is named Trichoderma sp. TKD. The purpose of this studywas to determine the species of Trichoderma sp. TKD and its ability in inhibiting the A. flavusFNCC6109. Identification of Trichoderma sp. TKD was done macroscopically, microscopically (ITS5F:5' GAAGTAAAAGTCGTAACAAGG-- 3' and ITS 4 R: 5 '- TCCTCCGCTTATTGATATGC - 3'). Thetest of the inhibitory power used dual culture metho

Abbreviation: Int. J. Pure App. Biosci. CODEN: IJPAB Language: English ISSN: 2320 – 7051 Start Year: 2013 . Publication: 6 issue pre year DOI: 10.18782/2320-7051 Published Articles: 633 International Citation Report (ICR) Impact factor: Global Impact Factor: 0.654 (2015) ISI Impact Factor: 1.106 (2014) SJIF Impact Factor: 5.358 (2015) Citation Welcome to IJPAB International Journal of Pure .