Transcription
Illumina Adapter SequencesIllumina Adapter SequencesThis document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illuminasequencing technologies. These sequences are provided for the sole purpose of understanding andpublishing the results of your sequencing experiments.Proprietary to IlluminaThe oligonucleotides are proprietary to Illumina. Their manufacture, use, and sequence information areprotected by intellectual property, including issued or pending patents, copyright, and trade secrets. Illuminareserves all rights in the oligonucleotides and their sequence information, except for the strictly limitedpermissions as follows.Most Illumina oligonucleotides are specially modified and purified in a proprietary manner to enable andoptimize their performance with Illumina instruments. Illumina is the only authorized supplier of the oligos.Illumina has no control over the quality, composition, or compatibility of reagents from unauthorized suppliers.We cannot troubleshoot or provide other support for experiments performed with unauthorized reagents, andwe cannot guarantee the performance of Illumina products when used with such reagents.Limited PermissionsYour permission to copy or distribute sequence information is limited to within your institution for use only withIllumina instruments and associated equipment, consumables, and software. You may not copy or distributethis information outside your institution, except under the following circumstances. You may distribute outside your institution and publish the sequence information in presentations,manuscripts, or publications authored by you, if the following copyright notice is included:Oligonucleotide sequences 2016 Illumina, Inc. All rights reserved. If you modify or adapt any sequence information contained in this letter and distribute or publish themodified sequences, you must include the following copyright notice:Oligonucleotide sequences 2016 Illumina, Inc. All rights reserved. Derivative works created byIllumina customers are authorized for use with Illumina instruments and products only. All otheruses are strictly prohibited.For all other uses of the sequence information or for questions on custom oligonucleotides, please contactIllumina to discuss the permissions or licenses that might be required.Document # 1000000002694 v01February 20161
Illumina Adapter SequencesContentsIntroduction . 5TruSight Amplicon Panels . 5Index 1 (i7) Adapters . 5Index 2 (i5) Adapter . 6TruSight Cardio . 6Index 1 (i7) Adapters . 6Index 2 (i5) Adapter . 7TruSight One . 7Index 1 (i7) Adapters . 7Index 2 (i5) Adapter . 7TruSight Rapid Capture . 8Index 1 (i7) Adapters . 8Index 2 (i5) Adapter . 8TruSight Tumor 15 . 9Index 1 (i7) Adapters . 9Index 2 (i5) Adapter . 10TruSight RNA Pan-Cancer Panel . 10Universal Adapter . 10Index Adapters . 10Illumina Nextera Library Prep Kits . 12Nextera Transposase Adapters . 12Nextera Index Kit – PCR Primers . 12Nextera Index Kit - Index 1 (i7) Adapters. 12Nextera Index Kit - Index 2 (i5) Adapters. 13Nextera XT Index Kit v2 - Index 1 (i7) Adapters. 13Nextera XT Index Kit v2 - Index 2 (i5) Adapters. 14TruSeq Amplicon Kits . 16Index 1 (i7) Adapters . 16Index 2 (i5) Adapter . 16TruSeq DNA Methylation . 17Index PCR Primers . 17Index Adapters . 17TruSeq HT Kits . 17D501–D508 Adapters . 17D701–D712 Adapters . 17Index 1 (i7) Adapters . 18Document # 1000000002694 v01February 20162
Illumina Adapter SequencesIndex 2 (i5) Adapters . 18TruSeq LT Kits and TruSeq v1/v2 Kits . 19TruSeq Universal Adapter . 19TruSeq Index Adapters (Index 1–27) . 19TruSeq Ribo Profile . 203’ Adapter . 20Forward PCR Primer. 20Index PCR Primers . 20Index Adapters . 21TruSeq Synthetic Long-Read DNA . 21Long Reads Adapter . 21TruSeq Small RNA . 21RNA 5’ Adapter (RA5) . 21RNA 3’ Adapter (RA3) . 21Stop Oligo (STP) . 21RNA RT Primer (RTP) . 22RNA PCR Index Primers (RPI1–RPI48) . 22TruSeq Targeted RNA Expression . 25Index 1 (i7) Adapters . 25Index 2 (i5) Adapter . 26Process Controls for TruSeq Kits . 27Nextera DNA Sample Prep Kit (Epicentre Biotechnologies) . 33Transposon Sequences . 33Adapters (showing optional bar code) . 33PCR Primers . 33Oligonucleotide Sequences for Genomic DNA . 33Adapters . 33PCR Primers . 33Genomic DNA Sequencing Primer . 33Oligonucleotide Sequences for Paired End DNA. 34PE Adapters . 34PE PCR Primer 1.0 . 34PE PCR Primer 2.0 . 34PE Read 1 Sequencing Primer . 34PE Read 2 Sequencing Primer . 34Oligonucleotide Sequences for the Multiplexing Sample Prep Oligo Only Kit34Multiplexing Adapters . 34Multiplexing PCR Primer 1.0. 34Document # 1000000002694 v01February 20163
Illumina Adapter SequencesMultiplexing PCR Primer 2.0. 34Multiplexing Read 1 Sequencing Primer . 34Multiplexing Index Read Sequencing Primer . 34Multiplexing Read 2 Sequencing Primer . 35PCR Primer Index Sequences 1–12 . 35Oligonucleotide Sequences for the v1 and v1.5 Small RNA Kits . 35RT Primer . 355' RNA Adapter . 363' RNA Adapter . 36v1.5 Small RNA 3' Adapter . 36Small RNA PCR Primer 1 . 36Small RNA PCR Primer 2 . 36Small RNA Sequencing Primer. 36Revision History . 37Document # 1000000002694 v01February 20164
Illumina Adapter SequencesIntroductionThis document lists the index adapter sequences for Illumina library prep kits. The sequences are groupedinto sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls andinformation for legacy Illumina kits.Sequencing on the MiniSeq, NextSeq, and HiSeq 3000/4000 systems follow a different dual-indexingworkflow than other Illumina systems, which requires the reverse complement of the i5 index adaptersequence. If you are creating a sample sheet manually for the MiniSeq, NextSeq, or HiSeq 3000/4000 systems,include the reverse complement of the sequence on your sample sheet.If you are using the Illumina Experiment Manager (IEM), BaseSpace Prep tab, or Local Run Manager torecord the adapter sequences, the software creates the reverse complement automatically.TruSight Amplicon PanelsIncludes TruSight Myeloid Sequencing Panel and TruSight Tumor 26Index 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ocument # 1000000002694 v01February 20165
Illumina Adapter SequencesIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 508TAGACCTATAGGTCTATruSight CardioIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ocument # 1000000002694 v01February 20166
Illumina Adapter SequencesIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetNextSeq, HiSeq 3000/4000E505GTAAGGAGCTCCTTACTruSight OneIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 504AGAGTAGATCTACTCTE505GTAAGGAGCTCCTTACDocument # 1000000002694 v01February 20167
Illumina Adapter SequencesTruSight Rapid CaptureIncludes TruSight Autism, TruSight Cancer, and TruSight Inherited DiseaseIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 506ACTGCATATATGCAGTE517GCGTAAGATCTTACGCDocument # 1000000002694 v01February 20168
Illumina Adapter SequencesTruSight Tumor 15Index 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ent # 1000000002694 v01February 20169
Illumina Adapter SequencesIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq ruSight RNA Pan-Cancer PanelUniversal Adapter5’ TCCGATCTAdapter, Index 1–125’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]ATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 135’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]CAATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 145’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]GTATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 15 and Index 215’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]GAATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 16 and Index 195’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]CGATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 185’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]ACATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 20 and Index 275’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]TTATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 225’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]TAATCTCGTATGCCGTCTTCTGCTTGAdapter, Index 23 and Index 255’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6 bases]ATATCTCGTATGCCGTCTTCTGCTTGIndex AdaptersIn this set of adapters, index numbering does not include numbers 17, 24, or 26.LT Set A/BIndex Name6-Base Sequence for Sample SheetBAR001ATCACGAAR002CGATGTDocument # 1000000002694 v01February 201610
Illumina Adapter SequencesLT Set A/BIndex Name6-Base Sequence for Sample 5ACTGATBAR027ATTCCTDocument # 1000000002694 v01February 201611
Illumina Adapter SequencesIllumina Nextera Library Prep KitsIncludes Nextera DNA, Nextera XT, Nextera Enrichment (obsolete), and Nextera Rapid CaptureNextera Transposase Adapters(Used for Nextera tagmentation)Read 15’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGRead 25’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNextera Index Kit – PCR PrimersIndex 1 Read5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGIndex 2 Read5’ tera Index Kit - Index 1 (i7) AdaptersBases in Adapteri7 Index Namei7 Bases for Sample ent # 1000000002694 v01February 201612
Illumina Adapter SequencesNextera Index Kit - Index 2 (i5) AdaptersThe i5 index names vary for different Nextera products as follows: N50x—Nextera DNAS50x—Nextera XTE50x—Nextera Enrichment and Nextera Rapid Capturei5 Bases for Sample SheetBases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq CGTAAGATCTTACGCNextera XT Index Kit v2 - Index 1 (i7) AdaptersBases in Adapteri7 Index Namei7 Bases for Entry on Sample GAGGATCATGAGCN714GCTCATGADocument # 1000000002694 v01February 201613
Illumina Adapter SequencesBases in Adapteri7 Index Namei7 Bases for Entry on Sample CGAN729TCGACGTCNextera XT Index Kit v2 - Index 2 (i5) Adaptersi5 Bases for Sample SheetBases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 6CCTAGAGTACTCTAGGDocument # 1000000002694 v01February 201614
Illumina Adapter Sequencesi5 Bases for Sample SheetBases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq ocument # 1000000002694 v01February 201615
Illumina Adapter SequencesTruSeq Amplicon KitsTruSeq Custom Amplicon 1.5, TruSeq Amplicon Cancer Panel, and TruSeq Custom Amplicon Low InputIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 508TAGACCTATAGGTCTADocument # 1000000002694 v01February 201616
Illumina Adapter SequencesTruSeq DNA MethylationIndex PCR Primers5’ CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTIndex AdaptersIndex Name6-Base Sequence for Sample SheetIndex 1ATCACGIndex 2CGATGTIndex 3TTAGGCIndex 4TGACCAIndex 5ACAGTGIndex 6GCCAATIndex 7CAGATCIndex 8ACTTGAIndex 9GATCAGIndex 10TAGCTTIndex 11GGCTACIndex 12CTTGTATruSeq HT KitsIncludes TruSeq DNA PCR-Free HT, TruSeq Nano HT, TruSeq Stranded mRNA HT, and TruSeq Total RNAHTD501–D508 CCCTACACGACGCTCTTCCGATCTD701–D712 GTATGCCGTCTTCTGCTTGDocument # 1000000002694 v01February 201617
Illumina Adapter SequencesIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adaptersi5 Index Namei5 Bases for Sample SheetMiSeq, HiSeq 2000/2500i5 Bases for Sample SheetMiniSeq, NextSeq, HiSeq 508GTACTGACGTCAGTACDocument # 1000000002694 v01February 201618
Illumina Adapter SequencesTruSeq LT Kits and TruSeq v1/v2 KitsIncludes TruSeq DNA PCR-Free LT, TruSeq Nano DNA LT, TruSeq DNA v1/v2/LT (obsolete), TruSeq RNAv1/v2/LT, TruSeq Stranded mRNA LT, TruSeq Stranded Total RNA LT, TruSeq RNA Access, and TruSeqChIPIndex sequences are 6 bases as underlined. Enter the underlined 6 bases on the sample sheet.TruSeq Universal Adapter5’ TCCGATCTTruSeq Index Adapters (Index 1–27)Index numbers 17, 24, and 26 are reserved.TruSeq Adapter, Index 15’ CGTCTTCTGCTTGTruSeq Adapter, Index 25’ CGTCTTCTGCTTGTruSeq Adapter, Index 35’ CGTCTTCTGCTTGTruSeq Adapter, Index 45’ CGTCTTCTGCTTGTruSeq Adapter, Index 55’ CGTCTTCTGCTTGTruSeq Adapter, Index 65’ CGTCTTCTGCTTGTruSeq Adapter, Index 75’ CGTCTTCTGCTTGTruSeq Adapter, Index 85’ CGTCTTCTGCTTGTruSeq Adapter, Index 95’ CGTCTTCTGCTTGTruSeq Adapter, Index 105’ CGTCTTCTGCTTGTruSeq Adapter, Index 115’ CGTCTTCTGCTTGTruSeq Adapter, Index 125’ CGTCTTCTGCTTGDocument # 1000000002694 v01February 201619
Illumina Adapter SequencesTruSeq Adapter, Index 135’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 145’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 155’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 165’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 185’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 195’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 205’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 215’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 225’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 235’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 255’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 275’ GCCGTCTTCTGCTTGTruSeq Ribo Profile3’ Adapter5’ AGATCGGAAGAGCACACGTCTForward PCR Primer5’ GIndex PCR Primers5’ CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTDocument # 1000000002694 v01February 201620
Illumina Adapter SequencesIndex AdaptersIndex Name6-Base Sequence for Sample AGCTTA011GGCTACA012CTTGTATruSeq Synthetic Long-Read DNADouble-stranded DNA adapter containing long-range PCR primer binding site, sequencing primer binding site,and end marker sequence.Long Reads Adapter5’ TAAGAGACAGTACGCTTGCATTruSeq Small RNARNA 5’ Adapter (RA5)5’ GUUCAGAGUUCUACAGUCCGACGAUCRNA 3’ Adapter (RA3)5’ TGGAATTCTCGGGTGCCAAGGStop Oligo (STP)5’ GAAUUCCACCACGUUCCCGUGGDocument # 1000000002694 v01February 201621
Illumina Adapter SequencesRNA RT Primer (RTP)5’ GCCTTGGCACCCGAGAATTCCARNA PCR Primer (RP1)5’ RNA PCR Index Primers (RPI1–RPI48)Index sequence is 6 bases as underlined. Enter the underlined 6 bases on the sample sheet. Indexsequences are read in the reverse complement in TruSeq small RNA libraries.RNA PCR Primer, Index 1 (RPI1)5’ CCCGAGAATTCCARNA PCR Primer, Index 2 (RPI2)5’ CCCGAGAATTCCARNA PCR Primer, Index 3 (RPI3)5’ CCCGAGAATTCCARNA PCR Primer, Index 4 (RPI4)5’ CCCGAGAATTCCARNA PCR Primer, Index 5 (RPI5)5’ CCCGAGAATTCCARNA PCR Primer, Index 6 (RPI6)5’ CCCGAGAATTCCARNA PCR Primer, Index 7 (RPI7)5’ CCCGAGAATTCCARNA PCR Primer, Index 8 (RPI8)5’ CCCGAGAATTCCARNA PCR Primer, Index 9 (RPI9)5’ CCCGAGAATTCCARNA PCR Primer, Index 10 (RPI10)5’ CCCGAGAATTCCARNA PCR Primer, Index 11 (RPI11)5’ CCCGAGAATTCCARNA PCR Primer, Index 12 (RPI12)5’ CCCGAGAATTCCARNA PCR Primer, Index 13 (RPI13)5’ CCCGAGAATTCCADocument # 1000000002694 v01February 201622
Illumina Adapter SequencesRNA PCR Primer, Index 14 (RPI14)5’ CCCGAGAATTCCARNA PCR Primer, Index 15 (RPI15)5’ CCCGAGAATTCCARNA PCR Primer, Index 16 (RPI16)5’ CCCGAGAATTCCARNA PCR Primer, Index 17 (RPI17)5’ CCCGAGAATTCCARNA PCR Primer, Index 18 (RPI18)5’ CCCGAGAATTCCARNA PCR Primer, Index 19 (RPI19)5’ CCCGAGAATTCCARNA PCR Primer, Index 20 (RPI20)5’ CCCGAGAATTCCARNA PCR Primer, Index 21 (RPI21)5’ CCCGAGAATTCCARNA PCR Primer, Index 22 (RPI22)5’ CCCGAGAATTCCARNA PCR Primer, Index 23 (RPI23)5’ CCCGAGAATTCCARNA PCR Primer, Index 24 (RPI24)5’ CCCGAGAATTCCARNA PCR Primer, Index 25 (RPI25)5’ CCCGAGAATTCCARNA PCR Primer, Index 26 (RPI26)5’ CCCGAGAATTCCARNA PCR Primer, Index 27 (RPI27)5’ CCCGAGAATTCCARNA PCR Primer, Index 28 (RPI28)5’ CCCGAGAATTCCARNA PCR Primer, Index 29 (RPI29)5’ CCCGAGAATTCCARNA PCR Primer, Index 30 (RPI30)5’ CCCGAGAATTCCADocument # 1000000002694 v01February 201623
Illumina Adapter SequencesRNA PCR Primer, Index 31 (RPI31)5’ CCCGAGAATTCCARNA PCR Primer, Index 32 (RPI32)5’ CCCGAGAATTCCARNA PCR Primer, Index 33 (RPI33)5’ CCCGAGAATTCCARNA PCR Primer, Index 34 (RPI34)5’ CCCGAGAATTCCARNA PCR Primer, Index 35 (RPI35)5’ CCCGAGAATTCCARNA PCR Primer, Index 36 (RPI36)5’ CCCGAGAATTCCARNA PCR Primer, Index 37 (RPI37)5’ CCCGAGAATTCCARNA PCR Primer, Index 38 (RPI38)5’ CCCGAGAATTCCARNA PCR Primer, Index 39 (RPI39)5’ CCCGAGAATTCCARNA PCR Primer, Index 40 (RPI40)5’ CCCGAGAATTCCARNA PCR Primer, Index 41 (RPI41)5’ CCCGAGAATTCCARNA PCR Primer, Index 42 (RPI42)5’ CCCG
into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy Illumina kits. Sequencing on the MiniSeq, NextSeq, and HiSeq 3000/4000 systems follow a different dual-indexing