Transcription
FLORIDA JUDICIAL BRANCHCourt Reporting ervice February 2015Office of the State Courn Administrator. Court ServicesFlorida Supreme Court Building500 South Duva l StreetTallahassee, FL 32399-1900Phone: 850-922-5094Fax: 850-414-1342www.f lcourts.org
IntroductionIn 2005, the Commission on Trial Court Performance and Accountability (TCP&A) approved the publication of theCourt Reporting Services Circuit Profiles. This publication was created for the purpose of providing courtmanagers with access to information on court reporting programs within Florida’s trial courts. Each circuit profilecontains court reporting circuit specific information such as fiscal allotments, staffing models, service deliverymodels, digital logistics, measurable workload outputs, contractual rates, and network configurations.In Florida’s trial courts, court reporting programs have evolved over the last decade as the trial courts haveadjusted to changes in the funding structure. Prior to 2004, court reporting programs were funded by the countiesand because some counties provided more funding than others, significant variations existed in the delivery ofservices across the state. Upon the implementation of Revision 7 to Article V of the Florida Constitution in 2004,circuits transitioned to being funded by the state. This funding shift allowed for equity in service delivery acrossthe circuits and thus, enabled the trials courts to work systematically towards similar court reporting goals. Sincethen, the courts have been working steadily to improve the effectiveness and efficiency of court reporting servicesstatewide. To keep pace with evolving court reporting programs, the profiles serve as a resource tool as wecontinue to explore and implement best business practices.In addition to the court reporting circuit profiles, the TCP&A has issued four reports to help guide the circuits onthe most efficient and effective management of court reporting services. The first report issued in December 2002in preparation for Revision 7 addresses the purpose, legal necessity, delivery methods, costs, and performancemeasurement of court reporting services. The second report issued in February 2005 outlines a Statewide Planfor Effective Use and Management of Court Reporting Services. This plan provides overall goals, objectives, andstrategies for court reporting services in Florida’s trial courts post-Revision 7. The third report issued in October2007 titled, Recommendations for the Provision of Court Reporting Services in Florida’s Trial Courts providesseveral standards of operation and best practices aimed at improving the efficient and effective functioning ofcourt reporting services. This report also includes proposed rule and statute revisions. The fourth report issued inNovember 2009 titled, Recommendations for the Provision of Court Reporting Services in Florida’s Trial Courts –Supplemental Report was issued to refine the proposed standards of operation and best practices originallysubmitted in the October 2007 report based on the release of SC08-1658 pertaining to court reporting rulerevisions. These reports may be viewed on the State Courts System’s website ats/publications/#reports
DefinitionsTo assist in reviewing the information contained in each profile, the following definitions (listed in the same orderthey appear on the profile) are provided:FY 2014-15 Fiscal Allotments – Indicates state funded recurring general revenue (GR) and trust authority asallotted by the Trial Court Budget Commission for court reporting services. FTE indicates total number ofemployees (GR and trust authority) dedicated to court reporting services. Budget amounts are listed by budgetcategory (salaries/benefits, operating, contractual/maintenance, and cost recovery).FY 2013-14 Expenditures – Indicates the annual direct service contractual and vendor maintenanceexpenditures.Overall Staffing Model – Indicates the staffing model(s) used to deliver court reporting services by county. Thereare three types of staffing models: 1) Pure employee model, 2) Pure contractual model, and 3) Hybrid modelwhich includes both employee and contractual models.Transcript Services Model - Indicates the entities (i.e., State Attorney, Public Defender, or Justice AdministrativeCommission) in which a circuit has a shared cost arrangement for court reporting transcription services. Under atranscript services model, transcription services are provided to one or more of these entities using courtresources in exchange for funds to cover the cost of transcription services. These funds are transferred to thecourt’s budget at the state level and cost sharing authority is allocated to the participating circuits.Monitoring Ratio (Best Practice) – The row labeled Monitoring Ratio (Best Practice) indicates the overallmonitoring ratio for all types of proceedings combined by county. Subsequent rows indicate the monitoring ratiofor each type of proceeding by county. Monitoring ratio is defined as the average number of proceedingsmonitored simultaneously per court employee and contractual staff (number of proceedings vs. court reporters).Monitoring ratios consider time to monitor and tag proceedings. Time for production of transcripts is notconsidered.Classifications (FTE Employees) – Indicates the total number of state funded court reporting FTEs byclassification and by county in which they are headquartered.Service Delivery – Indicates the service delivery type(s) used to deliver court reporting services for each type ofproceeding by county. The following is a description of each service delivery type:Steno – Refers to a stenograph machine that is operated by a court reporter. A court reporter, bypressing a system of keys, creates a series of letters and numbers that are printed on a scrolling papertape.CAT – Refers to computer-aided transcription in which a computer is added to stenograph machineallowing keystrokes to be recorded on a disk or in the internal memory of a computer, as well as on papertape.Real-Time - Known as real-time stenography, a court reporter uses a CAT system to translate a digitizedrecord contemporaneously, producing an unedited written document as the proceeding occurs. Theunedited text can be viewed immediately, and later corrected by the stenographer. The speed and qualityof this type of system is familiar to anyone who has followed the closed caption text of a live televisionprogram.
DefinitionsAnalog Audio – Refers to analog audio recording technology such as a tape recorder used to directlycapture and preserve actual sounds of spoken words. Analog audio recordings are stored on magnetic oranalog (cassette) tape.Analog Video - Refers to analog video cameras used to capture actual sounds as well as video. Analogvideo recordings are stored on magnetic or analog (VHS) tape.Digital – Refers to audio, and often video, recording of a court proceeding using digital technology thatmay be saved to a CD, DVD, network drive, or server. There are generally four distinctions of digital:1. Digital Portable - Refers to recording technology such as laptops, hand-held devices, MP3players, etc. to record court proceedings. Digital portable recordings may be stored digitally on aserver, CD or DVD.2. Digital Local - Commonly referred to as the ‘courtroom model’, digital local utilizes stationarydigital systems such as desktops or stand-alone servers to record proceedings in the courtroomor hearing room. This model requires a court reporter to be present in the courtroom to operatethe system. The court reporter ‘monitors’ the recording by logging speakers, making notations ofwho is present, checking sound quality, and providing playback when directed to do so by thejudge. This form of monitoring is referred to as ‘local monitoring’ because the court reporter isphysically present in the courtroom to monitor the recording.3. Digital Central - The digital central model utilizes a local area network to allow court reportersto monitor proceedings from a remote room located within the same building. Under this model,monitor workstations are placed in a central control room to allow staff to operate audio/videoequipment located in the courtroom. By integrating courtrooms to the central control room via anetwork, digital court reporters are capable of monitoring several courtrooms at once. This formof monitoring is referred to as ‘central monitoring’.4. Digital Remote - The digital remote model utilizes the same type of equipment as the ‘centralmodel’ however, court reporters monitor proceedings from a remote room located in a differentbuilding over a wide area network. This form of monitoring is referred to as ‘remote monitoring’because the court reporter is monitoring ‘remotely’ from a different building.Voice Writing – Refers to a court reporter who records words spoken in a court proceeding by speakingdirectly into a voice silencer, which is a hand-held mask containing a microphone.Number of Facilities - Refers to the total number of buildings where court proceedings are conducted. Thisincludes judicial centers, jails, etc.Courtrooms – The row labeled Courtrooms refers to the total number of courtrooms in each county. A courtroomis defined as a formal space in which a judge regularly holds court proceedings. In the trial courts, courtroomsinclude a bench, witness stand, jury box, a table for the plaintiff and the defendant, and other necessary amenitiessuch as podiums or miscellaneous desks. The Analog A/V row indicates the total number of courtrooms whereanalog A/V equipment is installed. The Digital A/V row indicates the total number of courtrooms where digital A/Vequipment is installed.Hearing Rooms – The row labeled Hearing Rooms refers to the total number of hearing rooms in each county. Ahearing room is defined as a room (judge chamber, conference room, etc.) that is utilized typically for conductingcivil (non-criminal) proceedings. Hearing rooms have no requirements for prisoner handling, are smaller in scale,and have a variety of agency specific support space requirements that differ from courtrooms. The Analog A/Vrow indicates the total number of hearing rooms where analog A/V equipment is installed. The Digital A/V rowindicates the total number of hearing rooms where digital A/V equipment is installed.
DefinitionsPercent of Courtrooms & Hearing Rooms w/Analog & Digital Recording Capacity – Refers to the percent oftotal courtrooms and hearing rooms integrated and configured with digital court recording technology.Handheld – Indicates the total number of digital portable hand-held devices and laptops used to record courtproceedings.Networked Monitoring Workstations – Refers to the total number of workstations that are used to enable staffto remotely or centrally monitor court proceedings as they are being recorded via a court distributed network.Primary/Video Servers – Refers to hardware computer systems that are used to provide one or more services toother users (clients) or devices on the network or internet.Secondary Servers – Refers to hardware computer systems that serve as back up to the primary server, but alsopreserve records created during the life of an organization for long-term preservation, such as archive servers.Standalone/Transcription Workstations - Refers to a stationary desktop computer that is primarily used for thepurpose of providing transcript production.Stenographic/Real Time Systems – Total systems used to enable staff to record proceedings stenographically.Digital Court Reporting Vendor – Refers to the digital court reporting vendor(s). Currently, seven vendors areon state contract: OpenCourt, BIS (Business Intelligence Solution, JAVS (Jefferson Audio Video Systems), FTR(For The Record), CourtSmart, VIQ Solutions, and Vericore.Digital Court Reporting Central and Remote Monitoring Network Diagram - Refers to the operational aspectsof a circuit’s digital court reporting central and remote monitoring network. For each court venue, the number ofrooms monitored centrally and remotely is indicated. For example, if a room is monitored centrally on a regularbasis, it is listed as ‘central monitored room’. If a room is monitored remotely on a regular basis, it is listed as‘remote monitored room’. The number of monitor workstations and servers integrated as part of the central andremote monitored network are also included. However, non-integrated devices, digital portable and digital localmonitored rooms are not captured in this diagram unless otherwise indicated by the circuit.FY 2013-14 Uniform Data Reporting – Refers to the summary of a circuit’s total court reporting Uniform DataReporting statistics for FY 2013-14.Number of Hours – Indicates, for the proceeding types listed, the total number of hours recordedfor each type of service delivery model. This does not include hours recording depositions,traveling, taking long breaks, or when a reporter appears for an event and no record is taken.Number of Pages – Indicates, for the proceeding types listed, the total number of transcript pagesproduced for each entity requesting transcripts from the courts. This does not include transcriptcopies made or deposition transcriptions.Number of Media Provided (CD, Audio or Video) – Indicates the total number of CDs, DVDs,cassette tapes, and video tapes provided to each entity requesting media from the courts. Thisdoes not include number of media provided to judges, court staff, or for archival purposes.Contractual Service Providers – Circuit-Wide Fee/Rate Structure – Indicates the rates and/or rate ranges thecircuit has established for the payment of contract vendor steno and digital appearances and for the payment ofcontract vendors providing steno and digital transcription services.
Court ReportingCircuit Profiles1st Judicial CircuitEscambia, Okaloosa,Santa Rosa & Walton CountiesFY 2014-15AllotmentsFY 2013-14ExpendituresFTESalaries & BenefitsOperatingDue ProcessContractual &Maintenance22.00 1,387,982 72,102 50,385Cost RecoveryTrust FundAuthorityGR & TrustContractualGR & TrustMaintenance 61,719 18,921 63,206FY 2014-15 Staffing & Service DeliveryEscambiaOkaloosaSanta RosaWaltonCircuit-WideOverall Staffing ModelHybridHybridHybridEmployeeHybridTranscript Services ModelSA/PDSA/PDSA/PDSA/PDSA/PDMonitoring Ratio (Best Practice)Circuit :11:11:11:11:11.75:11:11:11:11.25:1Trials (1:1)Capital cases (1:1)All other proceedings (3:1)Staffing ModelCounty CriminalTrials (1:1)2:12:12:11:11.75:1All other proceedings (3:1)2:12:12:11:11.75:12:12:12:11:11.5:1Dependency (2:1)2:11:02:11:11.5:1Termination of Parental Rights (1:1)2:11:01:11:11.25:1GM/CSEHO for Family Court (4:1)1:01:01:01:11:0Jimmy Ryce Trials (1:1)1:11:11:11:11:1Domestic Violence Injunctions 1334222100019Family CourtDelinquency (2:1)Baker/Marchman/Guardianship/Jimmy RyceOn-Site (4:1)Off-Site (1:1)Classifications (FTE Employee):Mgr., Court Reporting ServicesCourt Reporter II6210Court Reporter I10225Scopist10001Digital Court Reporter41106Circuit CriminalTrialsService DeliveryCapital casesAll other proceedingsSteno/Digital StenoStenoStenoSteno/DigitalSteno/Digital Central Steno/Digital Central Steno/Digital CentralCounty CriminalTrialsDigital CentralDigital CentralDigital CentralStenoDigital/StenoAll other proceedingsDigital CentralDigital CentralDigital CentralStenoDigital/StenoDelinquencyDigital CentralDigital CentralDigital CentralStenoDigital/StenoDependencyDigital CentralDigital PortableDigital CentralStenoDigital/StenoTermination of Parental RightsDigital CentralDigital PortableSteno/Digital CentralStenoDigital/StenoGM/CSEHOFamily CourtDigital PortableDigital PortableDigital PortableStenoDigital/StenoDomestic Violence InjunctionsDigital CentralDigital PortableDigital p/Jimmy tal PortableN/ADigital/Analog Audio/Steno
Court ReportingCircuit Profiles1st Judicial CircuitEscambia, Okaloosa,Santa Rosa & Walton CountiesDigital LogisticsEscambiaOkaloosaSanta RosaWaltonCircuit-Wide22127Courtrooms2386441Analog A/V00000Digital A/V2084032Hearing Rooms26147552Analog ed Monitoring Workstations53109Primary/Video Servers562013Secondary Servers32106Standalone/Transcription Workstations1334222Stenographic/Real Time rtSmartNumber of FacilitiesDigital A/VPercent of Courtrooms & Hearing Roomsw/Analog & Digital Recording CapacityDigital Court Reporting Vendor
First Judicial CircuitFY 2014-15Digital Court Reporting Central & Remote Monitoring NetworkEscambiaPensacola JuvenileJustice Center:PensacolaJuvenile JusticeCenterSanta RosaMiltonSRCCOkaloosaWaltonCrestviewOCC3 Remote Monitored RmsDeFuniakWCC3 Dependency Courtrooms1 Monitor Workstations3 ServersFortWaltonBeachAnnexExt.PensacolaMC Blanchard2 Primary1 SecondarySouth WaltonPensacola MC Blanchard:17 Central Monitored Rms17 Multi-Use Courtrooms4 Monitor Workstations5 Servers3 Primary2 SecondaryNetwork Lines:T-1 County Shared Network LineNote: Arrows at network line endpoints indicatedirection of remote monitoring. No arrows indicateno remote monitoring at this time.Milton Santa Rosa CountyCourthouse:4 Central Monitored RmsCrestview Okaloosa CountyCourthouse:2 Remote Monitored Rm2 Multi-Use Courtroom3 Multi-Use Courtrooms1 Dependency Courtroom0 Monitor Workstation1 Monitor Workstation3 Servers3 Servers2 Primary1 Secondary2 Primary1 SecondaryFort Walton BeachAnnex Ext.6 Central Monitored Rms6 Multi-Use Courtrooms3 Monitor Workstations5 Servers4 Primary1 SecondaryDeFuniak Walton CountyCourthouse:0 Central/Remote Rms0 Monitor Workstations0 ServersSouth Walton CountyCourthouse0 Central/remote Rms.0 Monitor Stations0 Servers
1st Judicial CircuitCourt ReportingCircuit ProfilesNumber of HoursFY 2013-14Number of PagesShared ModelUniform oTo Justice Administrative CommissionTo Court Appointed Indigent for CostCounselCounselRegional alCircuit 811145,2174506,48049,213259,175County 00000Domestic Violence 00000.000.00276.750.000.000.000000000000000Other Case 8404507,87649,2132511,293Magistrate/CSEHO (Family Law or Title IV-D)1,827.75 2,874.25LocalDigitalTo Private Partyor Other Gov'tTo PublicTo JudgesEntityTo State AttorneyDefenderNonNonNonAnalog or CourtAppealAppealAppeal AppealAppealAppealStaffAudio1,838.25 9,448.50Contractual Service Providers - Circuit-Wide Fee/Rate StructureStenoDigitalTranscriptionSteno# of Media Provided (CD, Audio or Video)Appearancesw NoticewoNoticew NoticewoNoticeRoutine DeliveryTo Private Party or Other Gov't Entity224To State Attorney243One HourOriginalTo Public Defender216Each Addt'l Qtr HourCopy w/OriginalTo JAC - Court Appointed Counsel2Each Addt'l Hour2nd Copy w/OriginalTo JAC - Indigent for Costs Counsel0Half-Day (1-4 hrs.)X-tra Copy (Non-Original)To JAC - Regional Counsel6Full-Day (4-8 hrs.)Expedited Delivery691Overtime per Hour1 Business DaySaturday (1-8 hrs.)2-3 Business DaysSunday (1-8 hrs.)Addt'l CopyTOTALCourt HolidayAppealCancellationCertified Transcript - CDOther:Non-Certified Transcript - CDOther:Digital Recording4.251.00DigitalSpecial NeedsServices- Appearance Fee of 75.00 forattendance at oneproceeding in themorning and oneproceeding in theafternoon.
Court ReportingCircuit Profiles2nd Judicial CircuitFranklin, Gadsden, Jefferson,Leon, Liberty & Wakulla CountiesFY 2014-15AllotmentsFY 2013-14ExpendituresFTESalaries & BenefitsOperatingDue ProcessContractual&Maintenance15.00 1,017,730 36,309 30,762 29,533FranklinGadsdenCostRecoveryTrust FundAuthorityGR & TrustContractualGR & TrustMaintenance 5,237 32,122FY 2014-15 Staffing & Service rall Staffing yeeEmployeeTranscript Services 1Monitoring Ratio (Best Practice)Circuit CriminalTrials (1:1)1:11:11:11:11:11:11:1Capital cases (1:1)1:11:11:11:11:11:11:1All other proceedings (3:1)2:12:12:12:11:12:12:1Trials (1:1)2:12:12:12:11:12:12:1All other proceedings (3:1)2:12:12:12:11:12:12:1Staffing ModelCounty CriminalFamily CourtDelinquency (2:1)2:12:12:12:11:12:12:1Dependency (2:1)2:12:12:12:11:12:12:1Termination of Parental Rights (1:1)2:12:12:12:11:12:12:1GM/CSEHO for Family Court 12:12:12:1Jimmy Ryce Trials (1:1)Domestic Violence Injunctions (3:1)Baker/Marchman/Guardianship/Jimmy RyceOn-Site (4:1)Off-Site (1:1)Classifications (FTE Employee):Mgr., Court Reporting Services02012011500010017Court Reporter II010600Court Reporter I0001001Digital Court Reporter0104016CATCATCATCATCATCATCATCircuit CriminalService DeliveryTrialsCapital casesCAT/Real Time CAT/Real Time CAT/Real TimeCAT/Real Time CAT/Real TimeCAT/Real TimeCAT/Real TimeAll other proceedingsDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteTrialsDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteAll other proceedingsDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteDelinquencyDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteDependencyDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteTermination of Parental RightsDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteGM/CSEHODigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteDomestic Violence InjunctionsDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteBaker/Marchman/Guardianship/Jimmy RyceDigital Remote Digital RemoteDigital RemoteDigital Remote Digital RemoteDigital RemoteDigital RemoteCounty CriminalFamily Court
Court ReportingCircuit Profiles2ND Judicial CircuitFranklin, Gadsden, Jefferson,Leon, Liberty & Wakulla CountiesDigital aCircuit-Wide22241112Courtrooms232221232Analog A/V0000000Digital A/V231161225Hearing Rooms110120115Analog 00000Networked Monitoring Workstations01080110Primary/Video Servers241181329Secondary Servers23141213Standalone/Transcription Workstations0000000Stenographic/Real Time OpenCourtOpenCourtOpenCourtNumber of FacilitiesDigital A/VPercent of Courtrooms & Hearing Roomsw/Analog & Digital Recording CapacityDigital Court Reporting Vendor
Second Judicial CircuitFY 2014-15Digital Court Reporting Central & Remote Monitoring NetworkLibertyWakullaFranklinGadsdenLeonJeffersonA pal a chi col aFCCBristol Llbertv CoyntvCoyrthoyse:1 Central/Remote RmsfElla0 Monitor Workstations2 ServersQuincy Gadsden CountyCourthouse:Iii'.!Apalachicola FranklinCoynty Courthouse:1 Remote Monitored Rm1 Remote Monitored Rm1 Multi-Use Courtroom 1 Multi-Use CourtroomI 1 Monitor Workstation2 Servers1 Primary1 Secondaryf Quincy Guy Race Annex:.i12 Remote Monitored Rm 2 Multi-Use Courtroomf fEl2 Remote Monitored Rms2 Multi-Use Courtrooms1 Monitor Workst ationsTallahassee LeonCounty Courthouse:1 6 Central Monitored Rms 16 Multi-Use Courtrooms5 Servers 3 PrimaryrJ.2 Secondary2 Servers1 Pri mary1 Secondary8 Monitor Workstations22 Ser vers17Primary4 Back Up1 ArchiveApalachicola Annex:Monticello Jeffersonfounty Courthouse:Ijg1 Remote Monitored Rm1 Multi-Use Courtroom0 Monitor Workstations2 Server1 Primary1 Secondary1 Remote Monitored Rm1 Multi-Use Courtroom2 Monitor Workstations5 Servers3 Primary2 Secondary0 Monitor WorkstationsCrawfordyille WakyllaCounty Coyrthoyse:I 0 Monitor Workstations2 Servers1 Primary1 SecondaryNetwork Lines:-T-1 State Co1Sts System Network LineNote: Arraws at network line endpoin ts indicat e direction of remotemonitoring .
2nd Judicial CircuitCourt ReportingCircuit ProfilesNumber of HoursFY 2013-14Number of PagesShared ModelUniform DataReportingRealTimeStenoCentralDigital3,702.00 2,761.00LocalDigitalAnalogVideoTo Private Partyor Other Gov'tTo PublicTo JudgesEntityTo State AttorneyDefenderNonNonNonAnalog or CourtAppealAppealAppeal AppealAppealAppealStaffAudioTo Justice Administrative CommissionTo Court Appointed Indigent for CostCounselCounselRegional alCircuit ,21977,4307184795237,846133855County 0069.000.000.000.000000000000000Domestic Violence Magistrate/CSEHO (Family Law or Title r Case ,846133855219.00TOTAL3,702.00 8,802.00Contractual Service Providers - Circuit-Wide Fee/Rate StructureStenoDigitalTranscriptionSteno# of Media Provided (CD, Audio or Video)Appearancesw NoticewoNoticew NoticewoNoticeDigitalRoutine DeliveryTo Private Party or Other Gov't Entity216To State Attorney155One HourOriginalTo Public Defender79Each Addt'l Qtr HourCopy w/OriginalTo JAC - Court Appointed Counsel13Each Addt'l Hour2nd Copy w/OriginalTo JAC - Indigent for Costs Counsel75Half-Day (1-4 hrs.)150.00To JAC - Regional Counsel51Full-Day (4-8 hrs.)60.00Expedited DeliveryTOTAL589Overtime per Hour60.001 Business DayX-tra Copy (Non-Original)3.751.25Saturday (1-8 hrs.)2-3 Business Days5.75Sunday (1-8 hrs.)Addt'l Copy2.50Court HolidayAppealCancellationCertified Transcript - CDOther:Non-Certified Transcript - CDOther:Digital RecordingSpecial NeedsServices15.00Note: Under a cost sharing arrangement, circuit, 14 provides transcripts to the appellate public defender of another circuit. To accurately reflect the delivery of these transcript services, certain public defender appeal transcript pages originally reportedby circuit 14 were shifted to circuit 2. Specifically, circuit criminal public defender transcript pages reported by circuit 14 (7,589 pages) was shifted to circuit 2.
Court ReportingCircuit Profiles3rd Judicial CircuitColumbia, Dixie, Hamilton, Lafayette,Madison, Suwannee & Taylor CountiesFY 2014-15AllotmentsFY 2013-14ExpendituresFTESalaries & BenefitsOperatingDue ProcessContractual&Maintenance6.00 354,233 17,680 7,322 11,369ColumbiaDixieCostRecoveryTrust Fund GR & Trust GR & TrustAuthority Contractual Maintenance 8,261 0FY 2014-15 Staffing & Service DeliveryHamilton LafayetteMadison SuwanneeTaylorCircuit-WideOverall Staffing yeeEmployeeEmployeeTranscript Services 1Trials (1:1)1:11:11:11:11:11:11:11:1Capital cases (1:1)1:11:11:11:11:11:11:11:1All other proceedings 1:13:13:13:13:13:13:13:13:1Delinquency (2:1)2:12:12:12:12:12:12:12:1Dependency (2:1)2:12:12:12:12:12:12:12:1Termination of Parental Rights (1:1)2:12:12:12:12:12:12:12:1GM/CSEHO for Family Court (4:1)4:14:14:14:14:14:14:14:1Jimmy Ryce Trials (1:1)1:11:11:11:11:11:11:11:1Domestic Violence Injunctions 4:01:01:01:01:01:01:01:01:060000006Monitoring Ratio (Best Practice)Circuit CriminalStaffing ModelCounty CriminalTrials (1:1)All other proceedings (3:1)Family CourtBaker/Marchman/Guardianship/Jimmy RyceOn-Site (4:1)Off-Site (1:1)Classifications (FTE Employee):Court Reporter II20000002Digital Court oStenoCircuit CriminalTrialsService DeliveryCapital italDigitalAll other talDigitalDigitalAll other proceedingsCounty CriminalFamily lDigitalTermination of Parental RightsGM/CSEHODomestic Violence InjunctionsBaker/Marchman/Guardianship/Jimmy RyceDigitalAnalog AudioAnalog Audio Analog AudioDigitalDigitalDigitalDigitalDigitalAnalog AudioAnalog AudioAnalog AudioAnalog AudioAnalog Audio
Court ReportingCircuit Profiles3rd Judicial CircuitColumbia, Dixie, Hamilton, Lafayette,Madison, Suwannee & Taylor CountiesDigital urtrooms421113214Analog A/V00000000Digital A/V421113214Hearing Rooms612223218Analog dhelds10000001Networked Monitoring Workstations40000004Primary/Vid
Court Reporting ervice February 2015 Office of the State Courn Administrator. Court Services Florida Supreme Court Building Phone: 850-922-5094 500 South Duval Street Fax: 850-414-1342 Tallahassee, FL 32399-1900 www.flcourts.org . Introduction
